Skip to main content

Tornado-RNA sensor for MALAT-1
(Plasmid #185406)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185406 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAV U6+27
  • Backbone manufacturer
    Addgene plasmid #129405
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    circular RNA-scaffolded sensing modules
  • Species
    Synthetic
  • Mutation
    WT
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer ccgtaacttgaaagtatttcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tornado-RNA sensor for MALAT-1 was a gift from Jian-Hui Jiang (Addgene plasmid # 185406 ; http://n2t.net/addgene:185406 ; RRID:Addgene_185406)
  • For your References section:

    Genetically Encoded Sensor Enables Endogenous RNA Imaging with Conformation-Switching Induced Fluorogenic Proteins. Zhou WJ, Li H, Zhang KK, Wang F, Chu X, Jiang JH. J Am Chem Soc. 2021 Sep 8;143(35):14394-14401. doi: 10.1021/jacs.1c07719. Epub 2021 Aug 25. 10.1021/jacs.1c07719 PubMed 34431301