pET21a(+)_co_L-HicDH
(Plasmid
#185453)
-
PurposeCDS of L-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 in pET21a(+).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET21a(+)
- Backbone size w/o insert (bp) 5367
- Total vector size (bp) 6297
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)NEB Stable
-
Growth instructionssee additional file or original article
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL-HicDH from Lactobacillus confusus DSM 20196
-
Alt namehydroxyisocaproate dehydrogenase from Lactobacillus confusus DSM 20196
-
SpeciesLactobacillus confusus DSM 20196
-
Insert Size (bp)957
-
GenBank IDM31425
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site Xhol (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a(+)_co_L-HicDH was a gift from Wolfgang Kroutil (Addgene plasmid # 185453 ; http://n2t.net/addgene:185453 ; RRID:Addgene_185453) -
For your References section:
Expression and activity of heterologous hydroxyisocaproate dehydrogenases in Synechocystis sp. PCC 6803 DeltahoxYH. Jurkas V, Winkler CK, Poschenrieder S, Oliveira P, Pacheco CC, Ferreira EA, Weissensteiner F, De Santis P, Kara S, Kourist R, Tamagnini P, Kroutil W. Eng Microbiol. 2021 Nov 26;2(1):100008. doi: 10.1016/j.engmic.2021.100008. eCollection 2022 Mar. 10.1016/j.engmic.2021.100008 PubMed 39628613