Skip to main content

pET21a(+)_co_L-HicDH
(Plasmid #185453)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185453 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET21a(+)
  • Backbone size w/o insert (bp) 5367
  • Total vector size (bp) 6297
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    see additional file or original article
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L-HicDH from Lactobacillus confusus DSM 20196
  • Alt name
    hydroxyisocaproate dehydrogenase from Lactobacillus confusus DSM 20196
  • Species
    Lactobacillus confusus DSM 20196
  • Insert Size (bp)
    957
  • GenBank ID
    M31425
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site Xhol (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET21a(+)_co_L-HicDH was a gift from Wolfgang Kroutil (Addgene plasmid # 185453 ; http://n2t.net/addgene:185453 ; RRID:Addgene_185453)
  • For your References section:

    Expression and activity of heterologous hydroxyisocaproate dehydrogenases in Synechocystis sp. PCC 6803 DeltahoxYH. Jurkas V, Winkler CK, Poschenrieder S, Oliveira P, Pacheco CC, Ferreira EA, Weissensteiner F, De Santis P, Kara S, Kourist R, Tamagnini P, Kroutil W. Eng Microbiol. 2021 Nov 26;2(1):100008. doi: 10.1016/j.engmic.2021.100008. eCollection 2022 Mar. 10.1016/j.engmic.2021.100008 PubMed 39628613