Skip to main content
Addgene

pCMV-T7-NLS(SV40)-anCas(PDCA)-BPNLS(SV40)-P2A-EGFP (LTH1430)
(Plasmid #185485)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185485 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Vector type
    Mammalian Expression ; in vitro transcription; T7 promoter
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human codon usage NLS-anCas(PDCA)-BPNLS-P2A-eGFP
  • Alt name
    LTH1430
  • Species
    Synthetic
  • Promoter CMV and T7
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • BPNLS-P2A-eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oBK6928 - CCAAGTCTCCACCCCATTGACG
  • 3′ sequencing primer oBK219 - GGGAGTGGCACCTTCCAGGGTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-T7-NLS(SV40)-anCas(PDCA)-BPNLS(SV40)-P2A-EGFP (LTH1430) was a gift from Benjamin Kleinstiver & Raul Perez-Jimenez (Addgene plasmid # 185485 ; http://n2t.net/addgene:185485 ; RRID:Addgene_185485)
  • For your References section:

    Evolution of CRISPR-associated endonucleases as inferred from resurrected proteins. Alonso-Lerma B, Jabalera Y, Samperio S, Morin M, Fernandez A, Hille LT, Silverstein RA, Quesada-Ganuza A, Reifs A, Fernandez-Penalver S, Benitez Y, Soletto L, Gavira JA, Diaz A, Vranken W, Sanchez-Mejias A, Guell M, Mojica FJM, Kleinstiver BP, Moreno-Pelayo MA, Montoliu L, Perez-Jimenez R. Nat Microbiol. 2023 Jan;8(1):77-90. doi: 10.1038/s41564-022-01265-y. Epub 2023 Jan 2. 10.1038/s41564-022-01265-y PubMed 36593295