Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-T7-NLS(SV40)-anCas(BCA)-BPNLS(SV40)-P2A-EGFP (LTH1384)
(Plasmid #185488)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185488 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Vector type
    Mammalian Expression ; in vitro transcription; T7 promoter
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human codon usage NLS-anCas(BCA)-BPNLS-P2A-eGFP
  • Alt name
    LTH1384
  • Species
    Synthetic
  • Promoter CMV and T7
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • BPNLS-P2A-eGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oBK6928 - CCAAGTCTCCACCCCATTGACG
  • 3′ sequencing primer oBK48 - GCAGAATTCCACCACACTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-T7-NLS(SV40)-anCas(BCA)-BPNLS(SV40)-P2A-EGFP (LTH1384) was a gift from Benjamin Kleinstiver & Raul Perez-Jimenez (Addgene plasmid # 185488 ; http://n2t.net/addgene:185488 ; RRID:Addgene_185488)
  • For your References section:

    Evolution of CRISPR-associated endonucleases as inferred from resurrected proteins. Alonso-Lerma B, Jabalera Y, Samperio S, Morin M, Fernandez A, Hille LT, Silverstein RA, Quesada-Ganuza A, Reifs A, Fernandez-Penalver S, Benitez Y, Soletto L, Gavira JA, Diaz A, Vranken W, Sanchez-Mejias A, Guell M, Mojica FJM, Kleinstiver BP, Moreno-Pelayo MA, Montoliu L, Perez-Jimenez R. Nat Microbiol. 2023 Jan;8(1):77-90. doi: 10.1038/s41564-022-01265-y. Epub 2023 Jan 2. 10.1038/s41564-022-01265-y PubMed 36593295