pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
(Plasmid
#185492)
-
PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFP
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneJDS246
-
Vector typeMammalian Expression ; in vitro transcription; T7 promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
-
Alt nameHES24
-
SpeciesSynthetic
-
MutationD10A
- Promoter CMV and T7
-
Tag
/ Fusion Protein
- BPNLS-3xFLAG-P2A-eGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer oBK6928 - CCAAGTCTCCACCCCATTGACG
- 3′ sequencing primer oBK219 - GGGAGTGGCACCTTCCAGGGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.30.485982v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24) was a gift from Benjamin Kleinstiver & Raul Perez-Jimenez (Addgene plasmid # 185492 ; http://n2t.net/addgene:185492 ; RRID:Addgene_185492) -
For your References section:
Evolution of CRISPR-associated endonucleases as inferred from resurrected proteins. Alonso-Lerma B, Jabalera Y, Samperio S, Morin M, Fernandez A, Hille LT, Silverstein RA, Quesada-Ganuza A, Reifs A, Fernandez-Penalver S, Benitez Y, Soletto L, Gavira JA, Diaz A, Vranken W, Sanchez-Mejias A, Guell M, Mojica FJM, Kleinstiver BP, Moreno-Pelayo MA, Montoliu L, Perez-Jimenez R. Nat Microbiol. 2023 Jan;8(1):77-90. doi: 10.1038/s41564-022-01265-y. Epub 2023 Jan 2. 10.1038/s41564-022-01265-y PubMed 36593295