pRDA_852
(Plasmid
#185527)
-
PurposeLentiviral vector that enables Cre-mediated expression of two sgRNAs. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXPR_220
-
Backbone manufacturerArlene Sharpe's Lab
- Backbone size w/o insert (bp) 7322
- Total vector size (bp) 10755
-
Modifications to backbone(1) Replaced FRT sequences within the tracrRNA of the first sgRNA cassette with loxP sites. (2) Added lox2272 sites within the tracrRNA of the second sgRNA cassette.
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR ; Flp/FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirst sgRNA cassette
-
Insert Size (bp)733
- Promoter Human U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer TGCAAATTAACCGGGGCAGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSecond sgRNA cassette
-
Insert Size (bp)2685
- Promoter Mouse U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BfuAI (destroyed during cloning)
- 3′ cloning site BfuAI (destroyed during cloning)
- 5′ sequencing primer CCCTGCCCCGGTTAATTTGC
- 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRDA_852 was a gift from Arlene Sharpe (Addgene plasmid # 185527 ; http://n2t.net/addgene:185527 ; RRID:Addgene_185527)