Skip to main content

pRDA_852
(Plasmid #185527)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185527 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXPR_220
  • Backbone manufacturer
    Arlene Sharpe's Lab
  • Backbone size w/o insert (bp) 7322
  • Total vector size (bp) 10755
  • Modifications to backbone
    (1) Replaced FRT sequences within the tracrRNA of the first sgRNA cassette with loxP sites. (2) Added lox2272 sites within the tracrRNA of the second sgRNA cassette.
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, CRISPR ; Flp/FRT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    First sgRNA cassette
  • Insert Size (bp)
    733
  • Promoter Human U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer TGCAAATTAACCGGGGCAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Second sgRNA cassette
  • Insert Size (bp)
    2685
  • Promoter Mouse U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuAI (destroyed during cloning)
  • 3′ cloning site BfuAI (destroyed during cloning)
  • 5′ sequencing primer CCCTGCCCCGGTTAATTTGC
  • 3′ sequencing primer TCTACTATTCTTTCCCCTGCACTGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRDA_852 was a gift from Arlene Sharpe (Addgene plasmid # 185527 ; http://n2t.net/addgene:185527 ; RRID:Addgene_185527)