TRE-RARa-VP16
(Plasmid
#185561)
-
PurposeDoxycycline inducible expression of constitutively active Retinoic Acid Receptor alpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185561 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCAGEN
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRARa-VP16
-
SpeciesM. musculus (mouse)
-
Entrez GeneRara (a.k.a. Nr1b1, RAR, RARalpha1)
- Promoter TRE
-
Tag
/ Fusion Protein
- VP16 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctcgaagcggccggccgccccgactcctacccaccgtactcgtcaa
- 3′ sequencing primer tagtgaaccgtcagatcgcctggaggccaccatggccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-RARa-VP16 was a gift from Connie Cepko (Addgene plasmid # 185561 ; http://n2t.net/addgene:185561 ; RRID:Addgene_185561) -
For your References section:
Retinoic acid signaling mediates peripheral cone photoreceptor survival in a mouse model of retina degeneration. Amamoto R, Wallick GK, Cepko CL. Elife. 2022 Mar 22;11. pii: 76389. doi: 10.7554/eLife.76389. 10.7554/eLife.76389 PubMed 35315776