Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TRE-RARa-VP16
(Plasmid #185561)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185561 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGEN
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RARa-VP16
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Rara (a.k.a. Nr1b1, RAR, RARalpha1)
  • Promoter TRE
  • Tag / Fusion Protein
    • VP16 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctcgaagcggccggccgccccgactcctacccaccgtactcgtcaa
  • 3′ sequencing primer tagtgaaccgtcagatcgcctggaggccaccatggccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRE-RARa-VP16 was a gift from Connie Cepko (Addgene plasmid # 185561 ; http://n2t.net/addgene:185561 ; RRID:Addgene_185561)
  • For your References section:

    Retinoic acid signaling mediates peripheral cone photoreceptor survival in a mouse model of retina degeneration. Amamoto R, Wallick GK, Cepko CL. Elife. 2022 Mar 22;11. pii: 76389. doi: 10.7554/eLife.76389. 10.7554/eLife.76389 PubMed 35315776