-
PurposeExpresses codon-optimized full length SARS-CoV-2 Delta Spike
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185593 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 8529
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Delta Spike
-
Alt nameSARS-CoV-2 B.1.617.2 Spike
-
Insert Size (bp)3810
-
MutationContains the following mutations: T19R, Δ156-157, R158G, L452R, T478K, D614G, P681R, D950N
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.02.19.481107v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 Delta Spike was a gift from Marceline Côté (Addgene plasmid # 185593 ; http://n2t.net/addgene:185593 ; RRID:Addgene_185593) -
For your References section:
Identification and differential usage of a host metalloproteinase entry pathway by SARS-CoV-2 Delta and Omicron. Benlarbi M, Laroche G, Fink C, Fu K, Mulloy RP, Phan A, Ariana A, Stewart CM, Prevost J, Beaudoin-Bussieres G, Daniel R, Bo Y, El Ferri O, Yockell-Lelievre J, Stanford WL, Giguere PM, Mubareka S, Finzi A, Dekaban GA, Dikeakos JD, Cote M. iScience. 2022 Nov 18;25(11):105316. doi: 10.1016/j.isci.2022.105316. Epub 2022 Oct 10. 10.1016/j.isci.2022.105316 PubMed 36254158