Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCAGGS SARS-CoV-2 BA.4/5 Spike
(Plasmid #186031)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186031 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4716
  • Total vector size (bp) 8523
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 BA.4/5 Spike
  • Alt name
    SARS-CoV-2 Omicron Spike
  • Insert Size (bp)
    3806
  • Mutation
    BA.2 mutations (T19I, LPPA24S, G142D, V213G, G339D, S371F, S373P, S375F, T376A, D405N, R408S, K417N, N440K, S477N, T478K, E484A, Q493R, Q498R, N501Y, Y505H, D614G, H655Y, N679K, P681H, N764K, D796Y, Q954H, N969K) with a Q493 reversion and Δ69-70, L452R and F486V
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.03.22278386 for medRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 BA.4/5 Spike was a gift from Marceline Côté (Addgene plasmid # 186031 ; http://n2t.net/addgene:186031 ; RRID:Addgene_186031)
  • For your References section:

    Spike recognition and neutralization of SARS-CoV-2 Omicron subvariants elicited after the third dose of mRNA vaccine. Tauzin A, Nicolas A, Ding S, Benlarbi M, Medjahed H, Chatterjee D, Dionne K, Gong SY, Gendron-Lepage G, Bo Y, Perreault J, Goyette G, Gokool L, Arlotto P, Morrisseau C, Tremblay C, Martel-Laferriere V, De Serres G, Levade I, Kaufmann DE, Cote M, Bazin R, Finzi A. Cell Rep. 2023 Jan 31;42(1):111998. doi: 10.1016/j.celrep.2023.111998. Epub 2023 Jan 9. 10.1016/j.celrep.2023.111998 PubMed 36656710