Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAGGS SARS-CoV-2 BA.1 Spike
(Plasmid #185452)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185452 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 8530
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike BA.1
  • Alt name
    Omicron Spike
  • Insert Size (bp)
    3813
  • Mutation
    Contains the following mutations: A67V, Δ69-70, T95I, G142D/Δ143-145, Δ211/L212I, ins214EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856K, Q954H, N969K, L981F
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 BA.1 Spike was a gift from Marceline Côté (Addgene plasmid # 185452 ; http://n2t.net/addgene:185452 ; RRID:Addgene_185452)
  • For your References section:

    SARS-CoV-2 Omicron Spike recognition by plasma from individuals receiving BNT162b2 mRNA vaccination with a 16-week interval between doses. Chatterjee D, Tauzin A, Marchitto L, Gong SY, Boutin M, Bourassa C, Beaudoin-Bussieres G, Bo Y, Ding S, Laumaea A, Vezina D, Perreault J, Gokool L, Morrisseau C, Arlotto P, Fournier E, Guilbault A, Delisle B, Levade I, Goyette G, Gendron-Lepage G, Medjahed H, De Serres G, Tremblay C, Martel-Laferriere V, Kaufmann DE, Bazin R, Prevost J, Moreira S, Richard J, Cote M, Finzi A. Cell Rep. 2022 Mar 1;38(9):110429. doi: 10.1016/j.celrep.2022.110429. Epub 2022 Feb 8. 10.1016/j.celrep.2022.110429 PubMed 35216664