pCAGGS SARS-CoV-2 D614G Spike
(Plasmid
#185692)
-
PurposeExpresses codon-optimized full length SARS-CoV-2 D614G Spike
-
Depositing Lab
-
Depositing OrganizationUniversity of Ottawa
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 185692-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 185692-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 8528
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 D614G Spike
-
Alt nameSARS-CoV-2 Spike
-
MutationContains the following mutation: D614G
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter chicken β-actin promoter, CMV enhancer
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.02.19.481107v1 for bioRxiv preprint.
DNA (Catalog # 185692-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 185692-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS SARS-CoV-2 D614G Spike was a gift from Marceline Côté (Addgene plasmid # 185692 ; http://n2t.net/addgene:185692 ; RRID:Addgene_185692) -
For your References section:
Identification and differential usage of a host metalloproteinase entry pathway by SARS-CoV-2 Delta and Omicron. Benlarbi M, Laroche G, Fink C, Fu K, Mulloy RP, Phan A, Ariana A, Stewart CM, Prevost J, Beaudoin-Bussieres G, Daniel R, Bo Y, El Ferri O, Yockell-Lelievre J, Stanford WL, Giguere PM, Mubareka S, Finzi A, Dekaban GA, Dikeakos JD, Cote M. iScience. 2022 Nov 18;25(11):105316. doi: 10.1016/j.isci.2022.105316. Epub 2022 Oct 10. 10.1016/j.isci.2022.105316 PubMed 36254158