PE-P3-rice
(Plasmid
#185612)
-
PurposeFor plant prime editing in rice plants
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCambia
- Total vector size (bp) 18409
-
Vector typeCRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3XFLAG-4XNLS-M-MLV-nCas9(H840A)-4XNLS-P2A-Hyg
-
Insert Size (bp)7671
- Promoter ZmUbi
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatcttgatatacttggatgatggc
- 3′ sequencing primer tctagtaacatagatgacaccgcgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PE-P3-rice was a gift from Jinxiao Yang (Addgene plasmid # 185612 ; http://n2t.net/addgene:185612 ; RRID:Addgene_185612) -
For your References section:
A design optimized prime editor with expanded scope and capability in plants. Xu W, Yang Y, Yang B, Krueger CJ, Xiao Q, Zhao S, Zhang L, Kang G, Wang F, Yi H, Ren W, Li L, He X, Zhang C, Zhang B, Zhao J, Yang J. Nat Plants. 2022 Jan;8(1):45-52. doi: 10.1038/s41477-021-01043-4. Epub 2021 Dec 23. 10.1038/s41477-021-01043-4 PubMed 34949802