Skip to main content

pJET-CMV-GFP-P2A-I15-P2A-mCherry
(Plasmid #185620)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185620 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJET1.2
  • Backbone manufacturer
    Thermo Scientific
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6177
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-I15-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3100
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgactcactatagggagagcggc
  • 3′ sequencing primer aagaacatcgattttccatggcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJET-CMV-GFP-P2A-I15-P2A-mCherry was a gift from Sabine Fuchs (Addgene plasmid # 185620 ; http://n2t.net/addgene:185620 ; RRID:Addgene_185620)
  • For your References section:

    Isoleucine-to-valine substitutions support cellular physiology during isoleucine deprivation. Kok G, Schene IF, Ilcken EF, Alcaraz PS, Mendes MI, Smith DEC, Salomons G, Shehata S, Jans JJM, Maroofian R, Hoek TA, van Es RM, Rehmann H, Nieuwenhuis EES, Vos HR, Fuchs SA. Nucleic Acids Res. 2025 Jan 7;53(1):gkae1184. doi: 10.1093/nar/gkae1184. 10.1093/nar/gkae1184 PubMed 39657787