pEPQD0CM0033
(Plasmid
#185624)
-
PurposeLevel 0 promoter from N. benthamiana used for sgRNA expression, nonstandard overlaps, GGAG-CTCG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUAP1
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNbU6-2
-
Alt namepUAP-NbU6-2 promoter
-
SpeciesNicotiana benthamiana
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GGCGTATCACGAGGCAGAATTTC
- 3′ sequencing primer CCTGCATAACGCGAAGTAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEPQD0CM0033 was a gift from Nicola Patron (Addgene plasmid # 185624 ; http://n2t.net/addgene:185624 ; RRID:Addgene_185624) -
For your References section:
Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O'Connor SE, Caputi L, Patron NJ. Commun Biol. 2022 Sep 10;5(1):949. doi: 10.1038/s42003-022-03904-w. 10.1038/s42003-022-03904-w PubMed 36088516