pCW57.1-FRB-MCU-Flag-TetOFF
(Plasmid
#185659)
-
PurposeTet/dox-repressible expression of N-terminus FRB tagged human mitochondrial calcium uniporter with C-terminus Flag epitope
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1-TetOFF
- Backbone size w/o insert (bp) 7479
- Total vector size (bp) 8517
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitochondrial calcium uniporter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1038
-
Entrez GeneMCU (a.k.a. C10orf42, CCDC109A, HsMCU)
- Promoter pTight TRE
-
Tags
/ Fusion Proteins
- Flag (C terminal on insert)
- FRB (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-FRB-MCU-Flag-TetOFF was a gift from Dipayan Chaudhuri (Addgene plasmid # 185659 ; http://n2t.net/addgene:185659 ; RRID:Addgene_185659) -
For your References section:
Mitochondrial calcium uniporter stabilization preserves energetic homeostasis during Complex I impairment. Balderas E, Eberhardt DR, Lee S, Pleinis JM, Sommakia S, Balynas AM, Yin X, Parker MC, Maguire CT, Cho S, Szulik MW, Bakhtina A, Bia RD, Friederich MW, Locke TM, Van Hove JLK, Drakos SG, Sancak Y, Tristani-Firouzi M, Franklin S, Rodan AR, Chaudhuri D. Nat Commun. 2022 May 19;13(1):2769. doi: 10.1038/s41467-022-30236-4. 10.1038/s41467-022-30236-4 PubMed 35589699