pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
(Plasmid
#185676)
-
PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERN1 gRNA
-
Alt nameIRE1alpha
-
Alt nameIRE1a
-
gRNA/shRNA sequenceCTGGGGCCACCAGAACAGAG
-
SpeciesH. sapiens (human)
-
Entrez GeneERN1 (a.k.a. IRE1, IRE1P, IRE1a, hIRE1p)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm was a gift from Peter Walter (Addgene plasmid # 185676 ; http://n2t.net/addgene:185676 ; RRID:Addgene_185676) -
For your References section:
Endoplasmic reticulum stress activates human IRE1alpha through reversible assembly of inactive dimers into small oligomers. Belyy V, Zuazo-Gaztelu I, Alamban A, Ashkenazi A, Walter P. Elife. 2022 Jun 22;11:e74342. doi: 10.7554/eLife.74342. 10.7554/eLife.74342 PubMed 35730415