pTW045
(Plasmid
#185690)
-
PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRANS_250d
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin ; Firefly Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9, Drm1b gRNAs
-
gRNA/shRNA sequencegtgtatggacgacgatatca; aatgcctctcccaaacccaa
-
SpeciesSetaria viridis
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTW045 was a gift from Feng Zhang (Addgene plasmid # 185690 ; http://n2t.net/addgene:185690 ; RRID:Addgene_185690) -
For your References section:
Optimization of multiplexed CRISPR/Cas9 system for highly efficient genome editing in Setaria viridis. Weiss T, Wang C, Kang X, Zhao H, Elena Gamo M, Starker CG, Crisp PA, Zhou P, Springer NM, Voytas DF, Zhang F. Plant J. 2020 Nov;104(3):828-838. doi: 10.1111/tpj.14949. Epub 2020 Sep 8. 10.1111/tpj.14949 PubMed 32786122