p221-RV-dlx-dio-Tdtomato
(Plasmid
#185697)
-
PurposeRetroviral vector expression cre-dependent membrane tagged Tdtomato driven by the mDlx promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneaddgene 87665
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 6857
- Total vector size (bp) 846
-
Modifications to backboneRemove CAG promoter, replace with mDlx promoter
-
Vector typeRetroviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemembrane Tdtomato
-
Alt nameTdt
-
Alt namemTdt
-
SpeciesSynthetic
- Promoter mDlx
-
Tag
/ Fusion Protein
- Gap43 palmitoylation (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AACCTCCTCGTTCGACCCCGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p221-RV-dlx-dio-Tdtomato was a gift from Lynette Lim (Addgene plasmid # 185697 ; http://n2t.net/addgene:185697 ; RRID:Addgene_185697)