p223-RV-dlx-dio-Tdtomato-T2A-SYPEGFP
(Plasmid
#185699)
-
PurposeRetroviral vector expression cre-dependent Tdtomato-T2A-SynaptophysinEGFP driven by the mDlx promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneaddgene 87667
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 6569
- Total vector size (bp) 3162
-
Modifications to backboneremove Synpasin promoter, replace with mDlx promoter. remove Tdtomato, remplace with Tdt-T2A-SypEGFP
-
Vector typeMammalian Expression, Retroviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTdtomato,
-
Alt nameTdt
-
SpeciesSynthetic
-
Insert Size (bp)1440
- Promoter mDlx
-
Tag
/ Fusion Protein
- T2A (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCACATAGCGTAAAAGGAGCA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSynaptophysin-EGFP
-
Alt nameSYP-EGFP
-
SpeciesSynthetic
- Promoter mDlx
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer GTGTCCACTCCCAGTTCAATTACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p223-RV-dlx-dio-Tdtomato-T2A-SYPEGFP was a gift from Lynette Lim (Addgene plasmid # 185699 ; http://n2t.net/addgene:185699 ; RRID:Addgene_185699)