Skip to main content

ATX3 13Q- I77K Q78K W87K
(Plasmid #185908)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185908 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDEST17
  • Backbone manufacturer
    pDEST, Gateway T7 Vectors
  • Backbone size w/o insert (bp) 6354
  • Modifications to backbone
    Inclusion of a TEV cleavage site after the 6x HIS-tag
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track and point mutations I77K, Q78K and W87K
  • Alt name
    ATXN3
  • Alt name
    SCA3
  • Alt name
    MJD
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1140
  • Mutation
    Point mutations in Atx3 gene I77K Q78K and W87K
  • GenBank ID
    NM_004993.6
  • Entrez Gene
    ATXN3 (a.k.a. AT3, ATX3, JOS, MJD, MJD1, SCA3)
  • Tags / Fusion Proteins
    • 6x His-Tag (N terminal on insert)
    • TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer T7- TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 term- GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATX3 13Q- I77K Q78K W87K was a gift from Sandra Macedo Ribeiro (Addgene plasmid # 185908 ; http://n2t.net/addgene:185908 ; RRID:Addgene_185908)
  • For your References section:

    A Robust Assay to Monitor Ataxin-3 Amyloid Fibril Assembly. Figueiredo F, Lopes-Marques M, Almeida B, Matscheko N, Martins PM, Silva A, Macedo-Ribeiro S. Cells. 2022 Jun 19;11(12). pii: cells11121969. doi: 10.3390/cells11121969. 10.3390/cells11121969 PubMed 35741099