Skip to main content

pET-His6-Sumo-CylK-Strep
(Plasmid #185962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185962 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Adgene 29711
  • Backbone size w/o insert (bp) 4466
  • Total vector size (bp) 7069
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CylK
  • Species
    Cylindrospermum licheniforme
  • Insert Size (bp)
    2403
  • GenBank ID
    ARU81125.1
  • Promoter T7
  • Tag / Fusion Protein
    • His6-Sumo (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAAGCGTTCGCTAAAAGACAGG
  • 3′ sequencing primer T7 Terminator
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-His6-Sumo-CylK-Strep was a gift from Emily Balskus (Addgene plasmid # 185962 ; http://n2t.net/addgene:185962 ; RRID:Addgene_185962)
  • For your References section:

    Structural basis for an unprecedented enzymatic alkylation in cylindrocyclophane biosynthesis. Braffman NR, Ruskoski TB, Davis KM, Glasser NR, Johnson C, Okafor CD, Boal AK, Balskus EP. Elife. 2022 Feb 25;11. pii: 75761. doi: 10.7554/eLife.75761. 10.7554/eLife.75761 PubMed 35212625