L_EGFP_AC
(Plasmid
#185971)
-
PurposeExpresses EGFP from PlLaco-1 promoter in E.coli Dh5alpha cell. For experiment use Dh5alphaz1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePz
-
Backbone manufacturerexpressys.
- Backbone size w/o insert (bp) 1720
- Total vector size (bp) 3199
-
Modifications to backboneInsertion of PlLacO-1 EGFP
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePl-LacO1-Egfp
-
SpeciesSynthetic
-
Insert Size (bp)1475
- Promoter PlLacO-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AatII (not destroyed)
- 3′ cloning site AvrII (not destroyed)
- 5′ sequencing primer GTTTTGGAGCACGGAAAGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.01.26.920629v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L_EGFP_AC was a gift from Sangram Bagh (Addgene plasmid # 185971 ; http://n2t.net/addgene:185971 ; RRID:Addgene_185971) -
For your References section:
A microgravity responsive synthetic genetic device in Escherichia coli. Mukhopadhyay S, Bagh S. Biosens Bioelectron. 2020 Nov 1;167:112462. doi: 10.1016/j.bios.2020.112462. Epub 2020 Aug 1. 10.1016/j.bios.2020.112462 PubMed 32781386