pOP004
(Plasmid
#185985)
-
PurposeEncodes a 0.8 kb bacterial transcription unit with Broccoli-tRNA fluorogenic aptamer shortly upstream of the intrinsic terminator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185985 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOA-RQ
-
Backbone manufacturerGeneArt (Thermo Fisher Scientific)
- Backbone size w/o insert (bp) 2414
- Total vector size (bp) 3340
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacterial transcription unit encoding Broccoli-tRNA fluorogenic aptamer
-
SpeciesSynthetic
-
Insert Size (bp)926
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer GAAACAGCTATGACCATGTTAATGCAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOP004 was a gift from Georgi Belogurov (Addgene plasmid # 185985 ; http://n2t.net/addgene:185985 ; RRID:Addgene_185985) -
For your References section:
Fluorogenic RNA aptamers to probe transcription initiation and co-transcriptional RNA folding by multi-subunit RNA polymerases. Huang YH, Trapp V, Puro O, Makinen JJ, Metsa-Ketela M, Wahl MC, Belogurov GA. Methods Enzymol. 2022;675:207-233. doi: 10.1016/bs.mie.2022.07.010. Epub 2022 Aug 19. 10.1016/bs.mie.2022.07.010 PubMed 36220271