pCMV Flag-LRRK2 K17A/K18A/R1441G
(Plasmid
#186013)
-
PurposeFlag-LRRK2 K17A/K18A/R1441G
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV Flag
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFlag-LRRK2 K17A/K18A/R1441G
-
SpeciesH. sapiens (human)
-
MutationSee depositor's comments below.
-
Entrez GeneLRRK2 (a.k.a. AURA17, DARDARIN, PARK8, RIPK7, ROCO2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCACGGGGATTTCCAAGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note this plasmid contains R61H and S1658T mutations in the insert. The mutations are not known to affect plasmid function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV Flag-LRRK2 K17A/K18A/R1441G was a gift from Suzanne Pfeffer (Addgene plasmid # 186013 ; http://n2t.net/addgene:186013 ; RRID:Addgene_186013) -
For your References section:
A feed-forward pathway drives LRRK2 kinase membrane recruitment and activation. Vides EG, Adhikari A, Chiang CY, Lis P, Purlyte E, Limouse C, Shumate JL, Spinola-Lasso E, Dhekne HS, Alessi DR, Pfeffer SR. Elife. 2022 Sep 23;11:e79771. doi: 10.7554/eLife.79771. 10.7554/eLife.79771 PubMed 36149401