LentiCRISPR-V2_mMSH2
(Plasmid
#186156)
-
PurposesgRNA targeting murine Msh2 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186156 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiCRISPR V2
- Backbone size w/o insert (bp) 12992
- Total vector size (bp) 13012
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMsh2_gRNA
-
gRNA/shRNA sequenceGGTTAATACCCTGATACAGT
-
SpeciesM. musculus (mouse)
-
Entrez GeneMsh2
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgattcc
- 3′ sequencing primer N/A (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiCRISPR-V2_mMSH2 was a gift from David McFadden (Addgene plasmid # 186156 ; http://n2t.net/addgene:186156 ; RRID:Addgene_186156) -
For your References section:
Engineering Forward Genetics into Cultured Cancer Cells for Chemical Target Identification. Povedano JM, Liou J, Wei D, Srivatsav A, Kim J, Xie Y, Nijhawan D, McFadden DG. Cell Chem Biol. 2019 Sep 19;26(9):1315-1321.e3. doi: 10.1016/j.chembiol.2019.06.006. Epub 2019 Jul 11. 10.1016/j.chembiol.2019.06.006 PubMed 31303577