mitoTALECD for_atp1_1397NC
(Plasmid
#186204)
-
PurposeFor genome editing (base editing) of Arabidopsis mitochondria, targeted C of RNA editing site of ATP1 by OTP87
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepK7WG2
-
Backbone manufacturerVIB, Ghent University
- Total vector size (bp) 22426
-
Modifications to backboneRPS5A promoter, Oleosin-GFP marker added in between Left and right border of T-DNA.
-
Vector typeSynthetic Biology ; Ti plasmid for plant transformation
-
Selectable markersKanamycin and seed GFP fluorescence by OleosinGFP for plant transformation
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemitochondrial targeted TALE left hand with 1397N of Cytidine Deaminase (mitoTALECD)
-
Alt namefor specific base editing of the RNA editing site C of ATP1 by OTP87
-
SpeciesSynthetic
-
Insert Size (bp)3303
-
GenBank ID
- Promoter Arabidopsis RPS5A
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGTTTAAACAAGCTTCTCG
- 3′ sequencing primer TAGCATCTTGATCTTGTTCTCACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemitochondrial targeted TALE right hand with 1397C of Cytidine Deaminase (mitoTALECD)
-
Alt namefor specific base editing of the RNA editing site C of ATP1 by OTP87
-
Insert Size (bp)3075
- Promoter Arabidopsis RPS5A
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGTTTAAACAAGCTTCTCG
- 3′ sequencing primer TAGCATCTTGATCTTGTTCTCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mitoTALECD for_atp1_1397NC was a gift from Shin-ichi Arimura (Addgene plasmid # 186204 ; http://n2t.net/addgene:186204 ; RRID:Addgene_186204) -
For your References section:
Targeted base editing in the mitochondrial genome of Arabidopsis thaliana. Nakazato I, Okuno M, Zhou C, Itoh T, Tsutsumi N, Takenaka M, Arimura SI. Proc Natl Acad Sci U S A. 2022 May 17;119(20):e2121177119. doi: 10.1073/pnas.2121177119. Epub 2022 May 13. 10.1073/pnas.2121177119 PubMed 35561225