Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mitoTALECD for_atp1_1397NC
(Plasmid #186204)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186204 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pK7WG2
  • Backbone manufacturer
    VIB, Ghent University
  • Total vector size (bp) 22426
  • Modifications to backbone
    RPS5A promoter, Oleosin-GFP marker added in between Left and right border of T-DNA.
  • Vector type
    Synthetic Biology ; Ti plasmid for plant transformation
  • Selectable markers
    Kanamycin and seed GFP fluorescence by OleosinGFP for plant transformation

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mitochondrial targeted TALE left hand with 1397N of Cytidine Deaminase (mitoTALECD)
  • Alt name
    for specific base editing of the RNA editing site C of ATP1 by OTP87
  • Species
    Synthetic
  • Insert Size (bp)
    3303
  • GenBank ID
  • Promoter Arabidopsis RPS5A

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGTTTAAACAAGCTTCTCG
  • 3′ sequencing primer TAGCATCTTGATCTTGTTCTCACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mitochondrial targeted TALE right hand with 1397C of Cytidine Deaminase (mitoTALECD)
  • Alt name
    for specific base editing of the RNA editing site C of ATP1 by OTP87
  • Insert Size (bp)
    3075
  • Promoter Arabidopsis RPS5A

Cloning Information for Gene/Insert 2

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGTTTAAACAAGCTTCTCG
  • 3′ sequencing primer TAGCATCTTGATCTTGTTCTCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mitoTALECD for_atp1_1397NC was a gift from Shin-ichi Arimura (Addgene plasmid # 186204 ; http://n2t.net/addgene:186204 ; RRID:Addgene_186204)
  • For your References section:

    Targeted base editing in the mitochondrial genome of Arabidopsis thaliana. Nakazato I, Okuno M, Zhou C, Itoh T, Tsutsumi N, Takenaka M, Arimura SI. Proc Natl Acad Sci U S A. 2022 May 17;119(20):e2121177119. doi: 10.1073/pnas.2121177119. Epub 2022 May 13. 10.1073/pnas.2121177119 PubMed 35561225