pAAV-TetO(3G)-GCaMP6f-WPRE
(Plasmid
#186205)
-
PurposeExpress GCaMP6f under TetO(3G)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV-TetO(3G)-WPRE
- Backbone size w/o insert (bp) 5080
- Total vector size (bp) 6299
-
Modifications to backboneGCaMP6f is inserted between ApaI and SalI site (blunted)
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
Alt nameGCaMP3-T302L R303P A317E D380Y T381R S383T R392G
-
SpeciesR. norvegicus (rat); A. victoria (jellyfish)
- Promoter TetO(3G)
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert) (N terminal on insert)
- T7 epitope (N terminal on insert)
- Xpress tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ApaI (destroyed during cloning)
- 3′ cloning site SalI (destroyed during cloning)
- 5′ sequencing primer TGGTCATCATCCTGCCTTTC
- 3′ sequencing primer gtggatacgctgctttaatgcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGCaMP6f: From Douglas Kim, GENIE project through Addgene (#40755)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.10.04.325324v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TetO(3G)-GCaMP6f-WPRE was a gift from Naoshige Uchida (Addgene plasmid # 186205 ; http://n2t.net/addgene:186205 ; RRID:Addgene_186205) -
For your References section:
A gradual temporal shift of dopamine responses mirrors the progression of temporal difference error in machine learning. Amo R, Matias S, Yamanaka A, Tanaka KF, Uchida N, Watabe-Uchida M. Nat Neurosci. 2022 Aug;25(8):1082-1092. doi: 10.1038/s41593-022-01109-2. Epub 2022 Jul 7. 10.1038/s41593-022-01109-2 PubMed 35798979