pAAV-TetO(3G)-GCaMP6f-WPRE
(Plasmid #186205)

• Purpose: Express GCaMP6f under TetO(3G)
• Depositing Lab: Naoshige Uchida
• Publication: Amo et al Nat Neurosci. 2022 Aug;25(8):1082-1092. doi: 10.1038/s41593-022-01109-2. Epub 2022 Jul 7.

Backbone

• Vector backbone: pAAV-TetO(3G)-WPRE
• Backbone size w/o insert (bp): 5080
• Total vector size (bp): 6299
• Modifications to backbone: GCaMP6f is inserted between ApaI and SalI site (blunted)
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GCaMP6f
• Alt name: GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
• Species: R. norvegicus (rat); A. victoria (jellyfish)
• Promoter: TetO(3G)
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert) (N terminal on insert)
  • T7 epitope (N terminal on insert)
  • Xpress tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (destroyed during cloning)
• 3′ cloning site: SalI (destroyed during cloning)
• 5′ sequencing primer: TGGTCATCATCCTGCCTTTC
• 3′ sequencing primer: gtggatacgctgctttaatgcc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GCaMP6f: From Douglas Kim, GENIE project through Addgene (#40755)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.10.04.325324v1 for bioRxiv preprint.