pLVX-IRES-Puro-KRAB-STAT3-3xFlag
(Plasmid
#186228)
-
PurposeExpressing KRAB domain fused to N terminal of STAT3 in human cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-IRES-Puro-3xFlag
-
Backbone manufacturerTakara Bio
- Backbone size w/o insert (bp) 8215
- Total vector size (bp) 10721
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSTAT3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2526
-
Entrez GeneSTAT3 (a.k.a. ADMIO, ADMIO1, APRF, HIES)
- Promoter CMV
-
Tags
/ Fusion Proteins
- KRAB (N terminal on insert)
- 3 x Flag (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-IRES-Puro-KRAB-STAT3-3xFlag was a gift from Xiufeng Bai (Addgene plasmid # 186228)