pAP01
(Plasmid
#186260)
-
PurposesfGFP under light light responsive PEL222 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186260 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSEVA531
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter PEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTATAGTCGAATAAA)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAAAGGCCCAGTCTTTC
- 3′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP01 was a gift from Yongku Cho (Addgene plasmid # 186260 ; http://n2t.net/addgene:186260 ; RRID:Addgene_186260) -
For your References section:
Optogenetics in Sinorhizobium meliloti Enables Spatial Control of Exopolysaccharide Production and Biofilm Structure. Pirhanov A, Bridges CM, Goodwin RA, Guo YS, Furrer J, Shor LM, Gage DJ, Cho YK. ACS Synth Biol. 2021 Feb 19;10(2):345-356. doi: 10.1021/acssynbio.0c00498. Epub 2021 Jan 19. 10.1021/acssynbio.0c00498 PubMed 33465305