pEGFP.N3-SLC35A2-GFP
(Plasmid
#186284)
-
Purposetransient expression of C-terminal GFP tagged SLC35A2 isoform c/UGT1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP.N3
- Total vector size (bp) 5876
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSLC35A2
-
SpeciesH. sapiens (human)
-
Entrez GeneSLC35A2 (a.k.a. CDG2M, CDGX, UDP-Gal-Tr, UGALT, UGAT, UGT, UGT1, UGT2, UGTL)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ATGTCGTAACAACTCCGCCC
- 3′ sequencing primer GCTGAACTTGTGGCCGTTTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP.N3-SLC35A2-GFP was a gift from Somshuvra Mukhopadhyay (Addgene plasmid # 186284 ; http://n2t.net/addgene:186284 ; RRID:Addgene_186284) -
For your References section:
Functional analyses of the UDP-galactose transporter SLC35A2 using the binding of bacterial Shiga toxins as a novel activity assay. Li D, Mukhopadhyay S. Glycobiology. 2019 Jun 1;29(6):490-503. doi: 10.1093/glycob/cwz016. 10.1093/glycob/cwz016 PubMed 30834435