pKL2299
(Plasmid #186332)

• Purpose: This plasmid carries the majority suite of Agrobacterium virulence genes from Ti plasmid pTiBo542. The additional copies of vir genes enhance Agrobacterium-mediated plant transformation.
• Depositing Lab: Kan Wang
• Publication: Kang et al Front Plant Sci. 2022 May 4;13:860971. doi: 10.3389/fpls.2022.860971. eCollection 2022.

Backbone

• Vector backbone: pRK2-AraE
• Backbone manufacturer: Brian Pfleger
• Backbone size w/o insert (bp): 3660
• Total vector size (bp): 29605
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: virulence genes from Agrobacterium tumefaciens pTiBo542
• Species: Agrobacterium tumefaciens
• Insert Size (bp): 25945
• GenBank ID: DQ058764.1

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgttcggtcaaggttctgga
• 3′ sequencing primer: aacacgcctgggtcaatgat

Resource Information

• Supplemental Documents:
  • pKL2299.gb
• A portion of this plasmid was derived from a plasmid made by: Qi-Jun Chen
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The vir genes were from pVS1-VIR2 (Plasmid #134745).
Zhang Q, Zhang Y, Lu MH, Chai YP, Jiang YY, Zhou Y, Wang XC, Chen QJ. A Novel Ternary Vector System United with Morphogenic Genes Enhances CRISPR/Cas Delivery in Maize. Plant Physiol. 2019 Dec;181(4):1441-1448. doi: 10.1104/pp.19.00767.