pKL2013
(Plasmid #172182)

• Purpose: A CRISPR/Cas9 vector targeting maize glossy2 gene for targeted mutagenesis with a mCherry as fluorescent marker.
• Depositing Lab: Kan Wang
• Publication: McCaw et al Front Genome Ed. 2021 Jan 11;2:622227. doi: 10.3389/fgeed.2020.622227. eCollection 2020.

Backbone

• Vector backbone: A844B
• Backbone manufacturer: Yiping Qi
• Backbone size w/o insert (bp): 16112
• Total vector size (bp): 17777
• Vector type: Plant Expression, CRISPR
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• GenBank ID: AJW76802.1
• Promoter: Cauliflower mosaic virus 35S promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (destroyed during cloning)
• 3′ cloning site: PacI (destroyed during cloning)
• 5′ sequencing primer: CAGGAAACAGCTATGAC
• 3′ sequencing primer: GTTGTGCAGATGATCCGTGG

Resource Information

• Supplemental Documents:
  • pKL2013.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene verified sequence differs from the depositor reference sequence. These discrepancies do not affect plasmid function.