Skip to main content

pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
(Plasmid #186413)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186413 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA
  • Backbone manufacturer
    PMID: 17878951
  • Backbone size w/o insert (bp) 5298
  • Vector type
    Gateway destination vector
  • Selectable markers
    ccdB gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacZ
  • Species
    E. coli
  • Entrez Gene
    lacZ (a.k.a. b0344, ECK0341)
  • Tag / Fusion Protein
    • Nuclear localization signal (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Fw_pSP172BSSPE: ACAGCTTGTCTGTAAGCGGATGC
  • 3′ sequencing primer Rv_pSP172BSSPE: TTGACACCAGACCAACTGGTAATG, SK primer
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway destination vector for electroporation experiments.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2 was a gift from Patrick Lemaire (Addgene plasmid # 186413 ; http://n2t.net/addgene:186413 ; RRID:Addgene_186413)
  • For your References section:

    A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, Missero C, Mueller F, Lemaire P. PLoS One. 2007. 2(9):e916. 10.1371/journal.pone.0000916 PubMed 17878951