Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2
(Plasmid #186414)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186414 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
  • Backbone manufacturer
    PMID: 17878951
  • Backbone size w/o insert (bp) 8537
  • Vector type
    Gateway destination vector
  • Selectable markers
    ccdB gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacZ
  • Species
    E. coli
  • Entrez Gene
    lacZ (a.k.a. b0344, ECK0341)
  • Promoter Basal promoter of the FOG gene
  • Tag / Fusion Protein
    • Nuclear localization signal (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Fw_pSP172BSSPE: ACAGCTTGTCTGTAAGCGGATGC
  • 3′ sequencing primer Rv_pSP172BSSPE: TTGACACCAGACCAACTGGTAATG, SK primer
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway destination vector for electroporation experiments.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-pSP172BSSPE-R3-ccdB/CmR-R4-bpFOG-B5::B1-NLSLacZ-B2 was a gift from Patrick Lemaire (Addgene plasmid # 186414 ; http://n2t.net/addgene:186414 ; RRID:Addgene_186414)
  • For your References section:

    A multicassette Gateway vector set for high throughput and comparative analyses in ciona and vertebrate embryos. Roure A, Rothbacher U, Robin F, Kalmar E, Ferone G, Lamy C, Missero C, Mueller F, Lemaire P. PLoS One. 2007. 2(9):e916. 10.1371/journal.pone.0000916 PubMed 17878951