pAAV-Ef1a-DIO-Egr3-EYFP-WPRE
(Plasmid
#186417)
-
PurposeOverexpression of Egr3 transcript variant 1 CDS under EF-1α promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-Ef1a-DIO EYFP
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 6313
- Total vector size (bp) 7487
-
Modifications to backboneEgr3 transcript variant CDS was inserted using restriction cloning by NcoI and NheI
-
Vector typeAAV
-
Selectable markersNot Applicable
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEarly growth response 3
-
Alt nameEgr3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1161
-
GenBank ID13655
-
Entrez GeneEgr3 (a.k.a. Pilot)
- Promoter EF-1-alpha
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer gctgaacttgtggccgttta
- 3′ sequencing primer tgaaagccatacgggaagca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO-Egr3-EYFP-WPRE was a gift from Mary Kay Lobo (Addgene plasmid # 186417 ; http://n2t.net/addgene:186417 ; RRID:Addgene_186417) -
For your References section:
Opposing role for Egr3 in nucleus accumbens cell subtypes in cocaine action. Chandra R, Francis TC, Konkalmatt P, Amgalan A, Gancarz AM, Dietz DM, Lobo MK. J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015. 10.1523/JNEUROSCI.0548-15.2015 PubMed 25995477