Skip to main content

pAAV-Ef1a-DIO-Egr3-EYFP-WPRE
(Plasmid #186417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-Ef1a-DIO EYFP
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 6313
  • Total vector size (bp) 7487
  • Modifications to backbone
    Egr3 transcript variant CDS was inserted using restriction cloning by NcoI and NheI
  • Vector type
    AAV
  • Selectable markers
    Not Applicable

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Early growth response 3
  • Alt name
    Egr3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1161
  • GenBank ID
    13655
  • Entrez Gene
    Egr3 (a.k.a. Pilot)
  • Promoter EF-1-alpha
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer gctgaacttgtggccgttta
  • 3′ sequencing primer tgaaagccatacgggaagca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO-Egr3-EYFP-WPRE was a gift from Mary Kay Lobo (Addgene plasmid # 186417 ; http://n2t.net/addgene:186417 ; RRID:Addgene_186417)
  • For your References section:

    Opposing role for Egr3 in nucleus accumbens cell subtypes in cocaine action. Chandra R, Francis TC, Konkalmatt P, Amgalan A, Gancarz AM, Dietz DM, Lobo MK. J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015. 10.1523/JNEUROSCI.0548-15.2015 PubMed 25995477