Skip to main content

pAAV-hSYn-DIO-ScramblemiR-IRES-mCitrine
(Plasmid #186418)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186418 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-hSyn-DIO-IRES-mCitrine
  • Backbone manufacturer
    Bryan Roth
  • Backbone size w/o insert (bp) 6181
  • Total vector size (bp) 6315
  • Vector type
    AAV
  • Selectable markers
    Not Applicable

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ScramblemiR
  • gRNA/shRNA sequence
    Control plasmid
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Promoter human Synapsin1
  • Tag / Fusion Protein
    • mCitrine (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer acaccggccttattccaagc
  • 3′ sequencing primer acgggccacaactcctcata
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSYn-DIO-ScramblemiR-IRES-mCitrine was a gift from Mary Kay Lobo (Addgene plasmid # 186418 ; http://n2t.net/addgene:186418 ; RRID:Addgene_186418)
  • For your References section:

    Opposing role for Egr3 in nucleus accumbens cell subtypes in cocaine action. Chandra R, Francis TC, Konkalmatt P, Amgalan A, Gancarz AM, Dietz DM, Lobo MK. J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015. 10.1523/JNEUROSCI.0548-15.2015 PubMed 25995477