pAAV-hSyn-DIO-Egr3-miR-IRES-mCitrine
(Plasmid
#186419)
-
PurposeExpression of shRNA for the knock down of mouse Egr3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hSyn-DIO-IRES-mCitrine
-
Backbone manufacturerBryan Roth
- Backbone size w/o insert (bp) 6181
- Total vector size (bp) 6315
-
Vector typeAAV
-
Selectable markersNot Applicable
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiREgr3-5D
-
gRNA/shRNA sequenceEarly Growth Response 3
-
SpeciesM. musculus (mouse)
-
GenBank ID13655
- Promoter human Synapsin1
-
Tag
/ Fusion Protein
- mCitrine
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer acaccggccttattccaagc
- 3′ sequencing primer acgggccacaactcctcata (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-Egr3-miR-IRES-mCitrine was a gift from Mary Kay Lobo (Addgene plasmid # 186419 ; http://n2t.net/addgene:186419 ; RRID:Addgene_186419) -
For your References section:
Opposing role for Egr3 in nucleus accumbens cell subtypes in cocaine action. Chandra R, Francis TC, Konkalmatt P, Amgalan A, Gancarz AM, Dietz DM, Lobo MK. J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015. 10.1523/JNEUROSCI.0548-15.2015 PubMed 25995477