pAAV-hSyn-DIO-Egr3-miR-IRES-mCitrine
(Plasmid #186419)

• Purpose: Expression of shRNA for the knock down of mouse Egr3
• Depositing Lab: Mary Kay Lobo
• Publication: Chandra et al J Neurosci. 2015 May 20;35(20):7927-37. doi: 10.1523/JNEUROSCI.0548-15.2015.

Backbone

• Vector backbone: pAAV-hSyn-DIO-IRES-mCitrine
• Backbone manufacturer: Bryan Roth
• Backbone size w/o insert (bp): 6181
• Total vector size (bp): 6315
• Vector type: AAV
• Selectable markers: Not Applicable

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miREgr3-5D
• gRNA/shRNA sequence: Early Growth Response 3
• Species: M. musculus (mouse)
• GenBank ID: 13655
• Promoter: human Synapsin1
• Tag / Fusion Protein:
  • mCitrine

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: StuI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: acaccggccttattccaagc
• 3′ sequencing primer: acgggccacaactcctcata

Resource Information

• Supplemental Documents:
  • pAAV-hSyn-DIO-Egr3-miR-IRES-mCitrine.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry