Skip to main content

pGEX-6P-HMP1_FABD
(Plasmid #186436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186436 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX-6P-1
  • Backbone size w/o insert (bp) 4970
  • Total vector size (bp) 5723
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HMP1 (F-actin Binding Domain)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    753
  • Entrez Gene
    hmp-1 (a.k.a. CELE_R13H4.4)
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site AvaI, BsoBI, PaeR7I, PspXI, XhoI, BmeT110I (unknown if destroyed)
  • 5′ sequencing primer GAGACATTGCAGAGTCAAGTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    C.elegans cDNA clones were provided by: Yuji Kohara, Professor Center for Genetic Resource Informaiton National Institute of Genetics Research Organization of Information and Systems Mishima 411-8540, Japan Fax: +81-55-981-6855 E-mail: [email protected]

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-6P-HMP1_FABD was a gift from Tina Izard (Addgene plasmid # 186436 ; http://n2t.net/addgene:186436 ; RRID:Addgene_186436)
  • For your References section:

    The nematode alpha-catenin ortholog, HMP1, has an extended alpha-helix when bound to actin filaments. Rangarajan ES, Smith EW, Izard T. J Biol Chem. 2023 Feb;299(2):102817. doi: 10.1016/j.jbc.2022.102817. Epub 2022 Dec 17. 10.1016/j.jbc.2022.102817 PubMed 36539037