pGEX-6P-HMP1_FABD
(Plasmid
#186436)
-
PurposeExpresses the HMP1 F-actin Binding domain (677-927) with an N-terminal GST tag and a PRescission Protease cleavage site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-1
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5723
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHMP1 (F-actin Binding Domain)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)753
-
Entrez Genehmp-1 (a.k.a. CELE_R13H4.4)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site AvaI, BsoBI, PaeR7I, PspXI, XhoI, BmeT110I (unknown if destroyed)
- 5′ sequencing primer GAGACATTGCAGAGTCAAGTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byC.elegans cDNA clones were provided by: Yuji Kohara, Professor Center for Genetic Resource Informaiton National Institute of Genetics Research Organization of Information and Systems Mishima 411-8540, Japan Fax: +81-55-981-6855 E-mail: [email protected]
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-6P-HMP1_FABD was a gift from Tina Izard (Addgene plasmid # 186436 ; http://n2t.net/addgene:186436 ; RRID:Addgene_186436) -
For your References section:
The nematode alpha-catenin ortholog, HMP1, has an extended alpha-helix when bound to actin filaments. Rangarajan ES, Smith EW, Izard T. J Biol Chem. 2023 Feb;299(2):102817. doi: 10.1016/j.jbc.2022.102817. Epub 2022 Dec 17. 10.1016/j.jbc.2022.102817 PubMed 36539037