Skip to main content

pET28-acatenin.22-906
(Plasmid #186460)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186460 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28
  • Backbone size w/o insert (bp) 5314
  • Total vector size (bp) 7972
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CTNNA1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2658
  • Entrez Gene
    CTNNA1 (a.k.a. CAP102, MDBS2, MDPT2)
  • Tag / Fusion Protein
    • His (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer ATTGCCAGCATTCCTCAACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28-acatenin.22-906 was a gift from Tina Izard (Addgene plasmid # 186460 ; http://n2t.net/addgene:186460 ; RRID:Addgene_186460)
  • For your References section:

    Distinct inter-domain interactions of dimeric versus monomeric alpha-catenin link cell junctions to filaments. Rangarajan ES, Smith EW, Izard T. Commun Biol. 2023 Mar 16;6(1):276. doi: 10.1038/s42003-023-04610-x. 10.1038/s42003-023-04610-x PubMed 36928388