Skip to main content

pPSV39-ugi
(Plasmid #186556)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186556 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPSV39-CV
  • Backbone size w/o insert (bp) 6041
  • Total vector size (bp) 6292
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ugi
  • Insert Size (bp)
    255
  • Promoter LacUV5

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGATTACGTGGCCTGTAGAC
  • 3′ sequencing primer CCCGTTTAGAGGCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPSV39-ugi was a gift from Joseph Mougous (Addgene plasmid # 186556 ; http://n2t.net/addgene:186556 ; RRID:Addgene_186556)
  • For your References section:

    Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Gallagher LA, Velazquez E, Peterson SB, Charity JC, Radey MC, Gebhardt MJ, Hsu F, Shull LM, Cutler KJ, Macareno K, de Moraes MH, Penewit KM, Kim J, Andrade PA, LaFramboise T, Salipante SJ, Reniere ML, de Lorenzo V, Wiggins PA, Dove SL, Mougous JD. Nat Microbiol. 2022 Jun;7(6):844-855. doi: 10.1038/s41564-022-01133-9. Epub 2022 Jun 1. 10.1038/s41564-022-01133-9 PubMed 35650286