Skip to main content

pBS10-riboE-dddAI
(Plasmid #186561)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186561 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBS10
  • Backbone size w/o insert (bp) 11121
  • Total vector size (bp) 11544
  • Vector type
    Bacterial Expression
  • Selectable markers
    Kanamycin in Firmicutes

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use kanamycin for selection in Firmicutes
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dddAI
  • Alt name
    dddI
  • Species
    Burkholderia cenocepacia
  • Insert Size (bp)
    372
  • Promoter pSpac(hy)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGATCCTTGAAGCTGTCCCT
  • 3′ sequencing primer CATAAGGGAGAGCGTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS10-riboE-dddAI was a gift from Joseph Mougous (Addgene plasmid # 186561 ; http://n2t.net/addgene:186561 ; RRID:Addgene_186561)
  • For your References section:

    Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Gallagher LA, Velazquez E, Peterson SB, Charity JC, Radey MC, Gebhardt MJ, Hsu F, Shull LM, Cutler KJ, Macareno K, de Moraes MH, Penewit KM, Kim J, Andrade PA, LaFramboise T, Salipante SJ, Reniere ML, de Lorenzo V, Wiggins PA, Dove SL, Mougous JD. Nat Microbiol. 2022 Jun;7(6):844-855. doi: 10.1038/s41564-022-01133-9. Epub 2022 Jun 1. 10.1038/s41564-022-01133-9 PubMed 35650286