pBS10-riboE-dddAI
(Plasmid
#186561)
-
PurposeRegulated expression of the DddA immunity determinant (DddAI) in Firmicutes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186561 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBS10
- Backbone size w/o insert (bp) 11121
- Total vector size (bp) 11544
-
Vector typeBacterial Expression
-
Selectable markersKanamycin in Firmicutes
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse kanamycin for selection in Firmicutes
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedddAI
-
Alt namedddI
-
SpeciesBurkholderia cenocepacia
-
Insert Size (bp)372
- Promoter pSpac(hy)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGATCCTTGAAGCTGTCCCT
- 3′ sequencing primer CATAAGGGAGAGCGTCGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS10-riboE-dddAI was a gift from Joseph Mougous (Addgene plasmid # 186561 ; http://n2t.net/addgene:186561 ; RRID:Addgene_186561) -
For your References section:
Genome-wide protein-DNA interaction site mapping in bacteria using a double-stranded DNA-specific cytosine deaminase. Gallagher LA, Velazquez E, Peterson SB, Charity JC, Radey MC, Gebhardt MJ, Hsu F, Shull LM, Cutler KJ, Macareno K, de Moraes MH, Penewit KM, Kim J, Andrade PA, LaFramboise T, Salipante SJ, Reniere ML, de Lorenzo V, Wiggins PA, Dove SL, Mougous JD. Nat Microbiol. 2022 Jun;7(6):844-855. doi: 10.1038/s41564-022-01133-9. Epub 2022 Jun 1. 10.1038/s41564-022-01133-9 PubMed 35650286