Skip to main content

pSF-p15A-T7- YFP
(Plasmid #186568)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186568 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSF-pA-PromMCS-KrYFP
  • Backbone manufacturer
    Oxgene
  • Backbone size w/o insert (bp) 4613
  • Total vector size (bp) 5706
  • Modifications to backbone
    PUC ori changed to p15A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    YFP
  • Alt name
    Kringle YFP (Yellow Fluorescence Protein)
  • Insert Size (bp)
    705
  • Promoter T7 promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATAGGCTGTCCCCAGTGC
  • 3′ sequencing primer TGTATCAGTCAGTCAGTGCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSF-p15A-T7- YFP was a gift from Teresa de Diego Puente (Addgene plasmid # 186568 ; http://n2t.net/addgene:186568 ; RRID:Addgene_186568)
  • For your References section:

    Impact of the Expression System on Recombinant Protein Production in Escherichia coli BL21. Lozano Terol G, Gallego-Jara J, Sola Martinez RA, Martinez Vivancos A, Canovas Diaz M, de Diego Puente T. Front Microbiol. 2021 Jun 21;12:682001. doi: 10.3389/fmicb.2021.682001. eCollection 2021. 10.3389/fmicb.2021.682001 PubMed 34234760