pSF-p15A-T7- YFP
(Plasmid
#186568)
-
Purposep15A ori, lacI PT7 promoter, AmpR. Kringle YFP (Yellow Fluorescence Protein) expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186568 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSF-pA-PromMCS-KrYFP
-
Backbone manufacturerOxgene
- Backbone size w/o insert (bp) 4613
- Total vector size (bp) 5706
-
Modifications to backbonePUC ori changed to p15A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYFP
-
Alt nameKringle YFP (Yellow Fluorescence Protein)
-
Insert Size (bp)705
- Promoter T7 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATAGGCTGTCCCCAGTGC
- 3′ sequencing primer TGTATCAGTCAGTCAGTGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSF-p15A-T7- YFP was a gift from Teresa de Diego Puente (Addgene plasmid # 186568 ; http://n2t.net/addgene:186568 ; RRID:Addgene_186568) -
For your References section:
Impact of the Expression System on Recombinant Protein Production in Escherichia coli BL21. Lozano Terol G, Gallego-Jara J, Sola Martinez RA, Martinez Vivancos A, Canovas Diaz M, de Diego Puente T. Front Microbiol. 2021 Jun 21;12:682001. doi: 10.3389/fmicb.2021.682001. eCollection 2021. 10.3389/fmicb.2021.682001 PubMed 34234760