Rtn2b-NTD136-271-mNeon
(Plasmid
#186604)
-
PurposeEncodes human Reticulon 2 isoform B N-terminal domain aa 136 to 271 fused to mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemNeonGreen-N1
- Total vector size (bp) 5112
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHuman Reticulon 2 isoform B amino acids 136 to 271
-
Alt nameRtn2b-NTD136-271
-
SpeciesH. sapiens (human)
-
Insert Size (bp)411
-
GenBank IDNM_206900.3
-
Entrez GeneRTN2 (a.k.a. NSP2, NSPL1, NSPLI, SPG12)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GCGGTAGGCGTGTACGG
- 3′ sequencing primer GTGTAACTCATGTGTCGCTGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rtn2b-NTD136-271-mNeon was a gift from Gia Voeltz (Addgene plasmid # 186604 ; http://n2t.net/addgene:186604 ; RRID:Addgene_186604) -
For your References section:
The ER ladder is a unique morphological feature of developing mammalian axons. Zamponi E, Meehl JB, Voeltz GK. Dev Cell. 2022 Jun 6;57(11):1369-1382.e6. doi: 10.1016/j.devcel.2022.05.002. Epub 2022 May 23. 10.1016/j.devcel.2022.05.002 PubMed 35609616