Skip to main content

pFastBac1-pGC-A
(Plasmid #186626)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 186626 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    Invitrogen; purchased via GenScript
  • Backbone size w/o insert (bp) 4682
  • Total vector size (bp) 7877
  • Modifications to backbone
    none
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPR1
  • Alt name
    particulate guanylate cyclase A (pGC-A)
  • Alt name
    atrial natriuretic peptide receptor type A (ANPR-A)
  • Alt name
    ANPa, ANPRA, GUC2A, GUCY2A, NPRA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3195
  • Mutation
    deleted amino acids 1-32
  • GenBank ID
    NP_000897.3 OL860945
  • Entrez Gene
    NPR1 (a.k.a. ANPRA, ANPa, GUC2A, GUCY2A, NPRA)
  • Promoter polyhedring
  • Tag / Fusion Protein
    • hemagglutinin (HA) signal peptide + His10-tag + TEV protease cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer POLYHEDF, AAATGATAACCATCTCGC
  • 3′ sequencing primer SV40PAR, GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GenScript gene synthesis of expression-optimized DNA
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

N-terminal protein sequence is MKTIIALSYIFCLVFA (hemagglutinin [HA] signal peptide) + HHHHHHHHHH + GAP (from AscI site) + ENLYFQ*G (TEV protease cleavage site; cleavage at * leaves an extra G residue at the N-terminus of pGC-A).
Backbone vector is pFastBac1.
Construct design by Shangji Zhang.
Generate the bacmid in Escherichia coli strain DH10Bac cells according to the instructions from Invitrogen.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac1-pGC-A was a gift from Debra Hansen (Addgene plasmid # 186626 ; http://n2t.net/addgene:186626 ; RRID:Addgene_186626)
  • For your References section:

    Purification, characterization, and preliminary serial crystallography diffraction advances structure determination of full-length human particulate guanylyl cyclase A receptor. Zhang S, Hansen DT, Martin-Garcia JM, Zook JD, Pan S, Craciunescu FM, Burnett JC Jr, Fromme P. Sci Rep. 2022 Jul 12;12(1):11824. doi: 10.1038/s41598-022-15798-z. 10.1038/s41598-022-15798-z PubMed 35821229