pFastBac1-pGC-A
(Plasmid #186626)

• Purpose: pFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)
• Depositing Lab: Debra Hansen
• Publication: Zhang et al Sci Rep. 2022 Jul 12;12(1):11824. doi: 10.1038/s41598-022-15798-z.

Backbone

• Vector backbone: pFastBac1
• Backbone manufacturer: Invitrogen; purchased via GenScript
• Backbone size w/o insert (bp): 4682
• Total vector size (bp): 7877
• Modifications to backbone: none
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NPR1
• Alt name: particulate guanylate cyclase A (pGC-A)
• Alt name: atrial natriuretic peptide receptor type A (ANPR-A)
• Alt name: ANPa, ANPRA, GUC2A, GUCY2A, NPRA
• Species: H. sapiens (human)
• Insert Size (bp): 3195
• Mutation: deleted amino acids 1-32
• GenBank ID: NP_000897.3 OL860945
• Entrez Gene: NPR1 (a.k.a. ANPRA, ANPa, GUC2A, GUCY2A, NPRA)
• Promoter: polyhedring
• Tag / Fusion Protein:
  • hemagglutinin (HA) signal peptide + His10-tag + TEV protease cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: POLYHEDF, AAATGATAACCATCTCGC
• 3′ sequencing primer: SV40PAR, GAAATTTGTGATGCTATTGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GenScript gene synthesis of expression-optimized DNA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

N-terminal protein sequence is MKTIIALSYIFCLVFA (hemagglutinin [HA] signal peptide) + HHHHHHHHHH + GAP (from AscI site) + ENLYFQ*G (TEV protease cleavage site; cleavage at * leaves an extra G residue at the N-terminus of pGC-A).
Backbone vector is pFastBac1.
Construct design by Shangji Zhang.
Generate the bacmid in Escherichia coli strain DH10Bac cells according to the instructions from Invitrogen.