pTE1059
(Plasmid #186628)

• Purpose: Expression of S. coelicolor butyrolactone biosynthesis genes in E. coli. Heterologous production of SCBs.
• Depositing Lab: Eriko Takano
• Publication: Biarnes-Carrera et al ACS Synth Biol. 2018 Apr 20;7(4):1043-1055. doi: 10.1021/acssynbio.7b00425. Epub 2018 Mar 19.

Backbone

• Vector backbone: pBbA2k
• Backbone size w/o insert (bp): 2700
• Total vector size (bp): 5713
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: scbA
• Alt name: SCO6266
• Species: Streptomyces coelicolor M145
• Insert Size (bp): 942
• Promoter: tetA
• Tag / Fusion Protein:
  • 6xHis-thrombin (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gatcttttaagaaggagatatacatATG

Gene/Insert 2

• Gene/Insert name: scbB
• Alt name: SCO6264
• Species: Streptomyces coelicolor M145
• Insert Size (bp): 777
• Promoter: Synthetic promoter B10
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTTAACTTTAAGAAGGAGATATACCATG

Gene/Insert 3

• Gene/Insert name: scbC
• Alt name: SCO6267
• Species: Streptomyces coelicolor
• Insert Size (bp): 858
• Promoter: Synthetic promoter B19
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtaacaaaagtgtctataatcacg

Resource Information

• Supplemental Documents:
  • pTE1059.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry