Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SETD2(SET)-Cas9
(Plasmid #186700)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 186700 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4718
  • Total vector size (bp) 10253
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SETD2(SET)-Cas9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5535
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SETD2(SET)-Cas9 was a gift from Jennifer Doudna (Addgene plasmid # 186700 ; http://n2t.net/addgene:186700 ; RRID:Addgene_186700)
  • For your References section:

    Decorating chromatin for enhanced genome editing using CRISPR-Cas9. Chen E, Lin-Shiao E, Trinidad M, Saffari Doost M, Colognori D, Doudna JA. Proc Natl Acad Sci U S A. 2022 Dec 6;119(49):e2204259119. doi: 10.1073/pnas.2204259119. Epub 2022 Dec 2. 10.1073/pnas.2204259119 PubMed 36459645